Polimorfizm genu syntazy glikogenu i cukrzyca zależna od insuliny

Dr Groop i wsp. (Wydanie z 7 stycznia) donosili, że w Finlandii allel A2 polimorfizmu Xbal genu syntazy glikogenu jest związany z cukrzycą insulinoniezależną (NIDDM) i identyfikuje podgrupę pacjentów z silny wywiad rodzinny w kierunku cukrzycy, wysoka częstość występowania nadciśnienia i insulinooporności. Badaliśmy ten polimorfizm u 231 niespokrewnionych białych pacjentów z NIDDM z multipleksowych rodzin francuskich z chorobą za pomocą amplifikacji genu syntazy glikogenu w reakcji łańcuchowej polimerazy (PCR) za pomocą starterów dostarczonych przez Dr. Groopa. Obecność alleli A1 i A2 porównano u pacjentów z cukrzycą i 52 zdrowych osób bez rodzinnej historii cukrzycy.
Częstość występowania allelu A1 była istotnie wyższa (96% vs. 88%), a allelu A2 istotnie niższa (4% w porównaniu z 12%) wśród chorych na cukrzycę niż wśród osób zdrowych (p = 0,006 analiza kwadratowa). Ponadto, częstość występowania allelu A1 wśród 92 pacjentów z cukrzycą, którzy mieli wywiad osobisty i rodzinny zarówno z cukrzycą, jak i nadciśnieniem tętniczym, był znacznie wyższy niż w grupie kontrolnej (p = 0,023). 19 chorych na cukrzycę (8 procent) z allelem A2 i 212 pacjentów (92 procent), którzy byli homozygotyczni (A1A1) byli podobni pod względem częstości występowania nadciśnienia; glukoza w osoczu, insulina, cholesterol lipoprotein o dużej gęstości i stężenia triglicerydów; i wskaźnik masy ciała.
W przeciwieństwie do wyników w Finlandii, polimorfizm XbaI genu syntazy glikogenu nie był związany z NIDDM we francuskiej populacji, a francuscy pacjenci z allelem A2 nie mieli profilu klinicznego sugerującego znaczącą insulinooporność.
Habib Zouali
Gilberto Velho, MD, Ph.D.
Philippe Froguel, MD, Ph.D.
Centre d Etude du Polymorphisme Humain, 75010 Paryż, Francja
Odniesienie1. Groop LC, Kankuri M, Schalin-Jantti C, i in. Związek pomiędzy polimorfizmem genu syntazy glikogenu a cukrzycą insulinoniezależną. N Engl J Med 1993; 328: 10-14
Full Text Web of Science MedlineGoogle Scholar
Czynniki genetyczne są ważne w patogenezie NIDDM, a mutacje genów insuliny, receptora insuliny i glukokinaz zidentyfikowano u pacjentów z NIDDM1,2. Jednak te mutacje są obecne tylko u kilku pacjentów z chorobą. U osób z Finlandii Groop i współpracownicy zidentyfikowali dwa polimorficzne allele trawieniem XbaI, A1 i A2 3. Allel A2 występował u 30 procent pacjentów z NIDDM, w porównaniu z 8 procentami normalnych osobników. Ponadto allel A2 był związany z silną historią rodzinną NIDDM.
Oceniliśmy częstość alleli A1 i A2 u 45 zdrowych osób i 95 pacjentów z NIDDM w Japonii. Normalni pacjenci byli w wieku od 18 do 60 lat i mieli prawidłową tolerancję glukozy i ujemny wywiad rodzinny w kierunku cukrzycy. Pacjenci z cukrzycą mieli 25 do 40 lat w chwili rozpoznania i mieli co najmniej dwóch członków rodziny z NIDDM. Stosując PCR na genomowym DNA z leukocytów od tych osobników, zamplifikowaliśmy region genomowego DNA obejmujący miejsce polimorfizmu XbaI (302 pary zasad w górę w intronie od pozycji 1970 komplementarnego DNA4) z dwoma starterami egzonowymi 5 CTGGACTGGAAATACCTAGG3 (1946 do 1965) i 5 TGTGGCGCGCAGACATATAG3 (1991 do 1972) flankujące intron Allele A1 i A2 określono przez trawienie XbaI produktu PCR, tak że allel A1 nie posiadał miejsca Xbal i allel A2 posiadał miejsce Xbal.
Allel A2 stwierdzono u 4 (9%) z 45 zdrowych osób i 9 (9%) z 95 pacjentów z NIDDM. Tak więc, chociaż częstość allelu A2 jest podobna u zdrowych osób w Japonii i Finlandii, nie stwierdziliśmy zwiększenia częstości występowania allelu A2 u japońskich pacjentów z NIDDM. Może to być spowodowane różnicami etnicznymi w podłożu genetycznym NIDDM. W rzeczywistości, japońscy pacjenci z NIDDM na ogół mają raczej zmniejszoną niż zwiększoną odpowiedź insuliny w osoczu na podawanie glukozy5. Alternatywnie, stopień nierównowagi sprzężenia między polimorfizmem XbaI a przypuszczalną chorobą wywołującą chorobę w genie syntazy glikogenu lub innym genie może być inny w populacji japońskiej.
Takashi Kadowaki, MD
University of Tokyo, Tokyo 113, Japan
Hiroko Kadowaki, MD
Instytut Opieki i Badań nad Cukrzycą, Fundacja Asahi Life, Tokyo 100, Japonia
Yoshio Yazaki, MD
University of Tokyo, Tokyo 113, Japan
5 Referencje1. Taylor SI, Kadowaki T, Kadowaki H, Accili D, Cama A, McKeon C. Mutacje w genie receptora insuliny u pacjentów opornych na insulinę. Diabetes Care 1990; 13: 257-279
Crossref Web of Science MedlineGoogle Scholar
2. Permutt MA, Chiu KC, Tanizawa Y. Glukokinaza i NIDDM: gen kandydata, który się opłacił. Diabetes 1992; 41: 1367-1372
Crossref Web of Science MedlineGoogle Scholar
3. Groop LC, Kankuri M, Schalin-Jantti C, i in. Związek pomiędzy polimorfizmem genu syntazy glikogenu a cukrzycą insulinoniezależną. N Engl J Med 1993; 328: 10-14
Full Text Web of Science MedlineGoogle Scholar
4. Browner MF, Nakano K, Bang AG, Fletterick RJ. Sekwencja cDNA ludzkiej syntazy glikogenu mięśniowego: ujemnie naładowane białko o asymetrycznym rozkładzie ładunku. Proc Natl Acad Sci USA 1989; 86: 1443-1447
Crossref Web of Science MedlineGoogle Scholar
5. Kadowaki T, Miyake Y, Hagura R i in. Czynniki ryzyka pogorszenia cukrzycy u osób z upośledzoną tolerancją glukozy. Diabetologia 1984; 26: 44-49
Crossref Web of Science MedlineGoogle Scholar
Autorzy odpowiadają:
Do redakcji: Przedstawione informacje na temat rozpowszechnienia polimorfizmu XbaI genu syntazy glikogenu u pacjentów z NIDDM we Francji i Japonii podkreślają potrzebę uzyskania danych z innych grup etnicznych. Wydaje się nawet, że są różnice w Finlandii. Nie stwierdziliśmy zwiększonej częstości występowania allelu A2 wśród pacjentów z NIDDM ze szwedzkiej mniejszości żyjącej w zachodniej Finlandii. Nie wiemy, dlaczego częstotliwość występowania allelu A2 jest zwiększona w populacji fińskiej.
Jeden lub więcej genów podatności na cukrzycę może występować u fińskich pacjentów z NIDDM, którzy mają wysokie ryzyko choroby niedokrwiennej serca1. Apolipoproteina E jest kandydatem do tak unikalnego fińskiego genu, a fenotypy apolipoproteiny E E4 / 4 i E4 / 3 są związane ze zwiększonym ryzykiem choroby niedokrwiennej serca u mężczyzn z NIDDM1. Co ciekawe, gen syntazy glikogenu został przypisany do chromosomu 19, pasmo q13.3 przylegające do apolipoproteiny E i genu kodującego apolipoproteiny C-II2 Zakładając, że zdefiniowaliśmy allele A1 i A2 w ten sam sposób, odkrycie zwiększonej częstotliwości allelu A1 wśród pacjentów z NIDDM we Francji jest zaskakujące, ale interesujące. Około 60 procent fińskich pacjentów z NIDDM ma nadciśnienie, a insulinooporność wydaje się występować tylko w obecności nadciśnienia3. Związek pomiędzy allelem A2 i nadciśnieniem występował również wśród 94 niespokrewnionych, bez cukrzycy krewnych pierwszego stopnia pacjentów z NIDDM (22 procent vs. 6 procent, P <0 [przypisy: synowektomia, czerwienica prawdziwa rokowania, rawmed rawicz ]

Ten wpis został opublikowany w kategorii Bez kategorii i oznaczony tagami , , . Dodaj zakładkę do bezpośredniego odnośnika.

0 odpowiedzi na „Polimorfizm genu syntazy glikogenu i cukrzyca zależna od insuliny

  1. Jigsaw pisze:

    od 3 dni boli mnie brzuch z prawej strony kłuje mnie cos

  2. Gustaw pisze:

    [..] Artukul zawiera odniesienia do tresci: szkoła wizażu[…]

  3. Speedwell pisze:

    Polecam sobie poczytać tutaj o konsekwencjach

  4. Disco Potato pisze:

    [..] Artukul zawiera odniesienia do tresci: aparat na zęby[…]

  5. Speedwell pisze:

    Profilakyka wlasnie ! 

Polimorfizm genu syntazy glikogenu i cukrzyca zależna od insuliny

Dr Groop i wsp. (Wydanie z 7 stycznia) donosili, że w Finlandii allel A2 polimorfizmu Xbal genu syntazy glikogenu jest związany z cukrzycą insulinoniezależną (NIDDM) i identyfikuje podgrupę pacjentów z silny wywiad rodzinny w kierunku cukrzycy, wysoka częstość występowania nadciśnienia i insulinooporności. Badaliśmy ten polimorfizm u 231 niespokrewnionych białych pacjentów z NIDDM z multipleksowych rodzin francuskich z chorobą za pomocą amplifikacji genu syntazy glikogenu w reakcji łańcuchowej polimerazy (PCR) za pomocą starterów dostarczonych przez Dr. Groopa. Obecność alleli A1 i A2 porównano u pacjentów z cukrzycą i 52 zdrowych osób bez rodzinnej historii cukrzycy. (więcej…)

Ten wpis został opublikowany w kategorii Bez kategorii i oznaczony tagami , , . Dodaj zakładkę do bezpośredniego odnośnika.

0 odpowiedzi na „Polimorfizm genu syntazy glikogenu i cukrzyca zależna od insuliny

  1. Sidewalk Enforcer pisze:

    poza błonnikiem należy przyjmowac antyoksydanty

  2. Skull Crusher pisze:

    [..] Oznaczono ponizsze tresci z artykulu oryginalnego: psycholog bielsko[…]

  3. Judge pisze:

    To bardzo dużo, powinieneś zgłosić się do lekarza